James R. Garey,  Andreas Schmidt-Rhaesa, Thomas J. Near & Steven A. Nadler
 

Abstract

 Advances in morphological and molecular studies of metazoan evolution have led to  a
better understanding of the relationships among  rotifers (Monogononta, Bdelloidea and
Seisonidea) and acanthocephalans, and their relationships to other bilateral animals.  The most
accepted morphological analysis places Acanthocephala as a sister group to Rotifera, although
other studies have placed Acanthocephala as a sister taxon to Bdelloidea or Seisonidea.
Molecular analyses using nuclear 18S rRNA and mitochondrial 16S rRNA genes support
Acanthocephala as a sister taxon to Bdelloidea, although no molecular data is available for
Seisonidea.  Combining molecular and morphological analyses of Bilateria leads to a tree with
Platyhelminthes, Rotifera, Acanthocephala and Gnathostomulida (and probably Gastrotricha) as
a sister group to the annelid-mollusc lineage of the Spiralia (Lophotrochozoa).

Figure 1.  Possible relationships between Seisonidea (S), Monogononta (M) and Bdelloidea (B).
1: Clefts but no pores in terminal organ of the protonephridia; rotatory organ; unpaired
retrocerebral glands; salivary glands integrated into the mastax (Ahlrichs, 1997); vitellarium
(Wallace & Colburn, 1989).  2: Paired ovaries, ramate mastax, absence of secreted tube (Pennak,
1989).  3: Males present, no bladder, cellular stomach with microvilli (Ricci et al., 1993),
similarities of internal layer in their syncytial integument (Clement, 1993).

Figure 2.  Proposed relationships between Seisonidea (S), Monogononta (M), Bdelloidea (B) and
Acanthocephala (A).  1: Internal layer of syncytial epidermis.  2: Lemnisci and proboscis present
(Lorenzen, 1985).  3: Pseudocoel present, syncytial epidermis, monociliated pit absent,
hermaphorditism absent, acrosome present, anteriorly inserting flagellum on sperm (Wallace et
al., 1996), internal layer in the syncytial epidermis (Nielsen, 1995). 4: Parthenogenesis,
hypodermic impregnation, collagen absent (Wallace et al., 1996), toes with adhesive glands
(Nielsen 1995).  5: Internal layer in the syncytial epidermis, anteriorly inserted flagellum on
sperm cell, outer epidermal cell membrane intrusions with bulbs.  6: Dense bodies within
spermatozoa, epidermis with filament bundles (Ahlrichs, 1997).

Figure 3.  Molecular phylogeny of Bilateria based on the 18S rRNA gene.  The tree shown is a
strict consensus of NJ, MP, and ML analyses (modified after Garey et al., 1996a).  Numbers
above and below each fork represent the percentage of 1,000 bootstrap replicates that support the
branch in the MP and NJ trees respectively. Numbers to the right of each fork are CP values from
the NJ tree.  Values are shown only when greater than 50. The Rotifera + Acanthocephala clade,
Bdellodea + Acanthocephala clade, and the Acanthocephala clade were all supported by decay
indices greater than 20.  Taxon abbreviations: Artemia salina (Arthropoda), Asa;  Tenebrio
molitor (Arthropoda), Tmo;  Eurypelma californica (Arthropoda), Eca;  Priapulus caudatus
(Priapulida), Pca; Limicolaria kambeul (Mollusca), Lka;  Acanthopleura japonica (Mollusca),
Aja; Placopecten magellanicus (Mollusca), Pma;  Eisenia foetida (Annelida), Efo; Lanice
conchilega (Annelida), Lco; Brachionus plicatilis (Rotifera), Bpl;  Philodina acuticornis
(Rotifera), Pac; Moniliformis moniliformis (Acanthocephala),  Mmo;  Neoechinorhynchus
pseudemydis (Acanthocephala), Nps; Centrorhynchus conspectus (Acanthocephala), Cco;
Lepidodermella squammata (Gastrotricha),  Lsq; Opisthorchis viverrini (Platyhelminthes), Ovi.
See Garey et al. (1996a) for Genbank accession numbers and other details of the analysis.

Figure  4.  The tree from Figure 3 drawn with branch lengths proportional to evolutionary
distance to illustrate the unequal evolutionary rates of rotifers and acanthocephalans.  The rotifer
P. acuticornis and the acanthocephalan C. conspectus are evolving at a rate approximately 5
times as fast as most other taxa in the tree.   When the fastest evolving rotifer sequence (P.
acuticornis) was removed from the analysis, the acanthocephalans remained as a sister taxon of
the rotifers.  When the fastest acanthocephalan sequence (C. conspectus) was removed, the other
acanthocephalans remained within the rotifer clade, demonstrating that the position of
acanthocephalans as a sister taxon to bdelloid rotifers is not likely to be an artifact due to
unequal rate effects (modified after Garey et al., 1996a).  Taxon labels are defined in Figure 3.

Figure 5. Molecular phylogeny of Bilateria based on a 600 bp fragment of the mitochondrial 16S
rRNA gene.  The tree shown is a NJ tree.  Bootstrap values for Kimura distances with gamma
correction (a = 0.72) are shown above the forks, values for Tamura & Nei distances are below
and numbers to the right are CP values for Kimura distances.  See Kumar et al. (1994) for details.
The same topology was recovered with all NJ analyses and with ML analysis with multiple rate
categories but not with MP or ML analysis without multiple rate categories (see text).  Taxon
abbreviations and Genbank accession numbers: Artemia salina, Asa, M21833; Brachionus
plicatilis, Bpl, AF108106; Homo sapiens, Hsa, D38112; Katherina tunicata, Ktu, U09810;
Moniliformis moniliformis, Mmo, AF108107; Mytilus edulis, Med, M83756; Philodina
acuticornis, Pac, AF108108; Strongylocentrotus purpuratus, Spu, X12631; Xenopus laevis, Xla,
X01601. Portions of mitochondrial 16S rRNA genes corresponding to a  sea urchin 16S rRNA
gene  (Genbank Accession 12825) from nucleotides 814-833 and 1406-1425 were PCR amplified
from cellular  DNA isolated from P. acuticornis, B. plicatilis, and M. moniliformis, and resulted
in a fragment about 600 nucleotides in length. Primers were 16S-RNA1:16S-RNA1
CCGGAATTCCGCCTGTTTATCAAAAACAT, and 16S-RNA2:
CCCAAGCTTCTCCGGTTTGAACTCAGATC, which have  EcoRI  and HindIII site tails
respectively.  PCR products were cloned into M13 and sequenced in both directions.  All
sequences were aligned according to a secondary structure model (De Rijk & De Wachter, 1993)
and trees produced using MEGA (Kumar et al., 1994) for NJ trees and PHYLIP (Felsenstein
1993) for ML and MP trees.  Sites with gaps were not used in the analyses.

Figure 6.  Proposed position of Rotifera within the Bilateria based on morphological and
molecular data. The annelid-mollusc lineage refers to the bulk of the non-ecdysozoan
protostomes, but not necessarily all of them.  Only a few key characters are given. 1: Blastopore
becomes the anus. 2: Ventral lateral nerve chord (Ahlrichs, 1995).  3: Molting by ecdysis
(Aguinaldo et al., 1997). 4: Spiral cleavage. 5: Filiform sperm without accessory centriole
(Ahlrichs, 1995).  6. Biciliary terminal cell in the protonephridia (Ax, 1996).  7: Jaws composed
of rods imbedded in a cuticular matrix (Ahlrichs, 1997).  8: Internal layer in the syncytial
epidermis (Storch & Welsch 1969).